View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0450_low_12 (Length: 251)

Name: NF0450_low_12
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0450_low_12
NF0450_low_12
[»] chr8 (1 HSPs)
chr8 (1-150)||(41094099-41094248)


Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 41094248 - 41094099
Alignment:
1 atcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaatccttcatagttactattattgtcatcttcaaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
41094248 atcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaatccttcatagttactattgttgtcatcttcaaaa 41094149  T
101 ggtcctcctactactactcctcctcctccaccagtggttggagattgatg 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
41094148 ggtcctcctactactactcctcctcctccaccagtggttggagattgatg 41094099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University