View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_12 (Length: 251)
Name: NF0450_low_12
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0450_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 41094248 - 41094099
Alignment:
Q |
1 |
atcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaatccttcatagttactattattgtcatcttcaaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
41094248 |
atcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaatccttcatagttactattgttgtcatcttcaaaa |
41094149 |
T |
 |
Q |
101 |
ggtcctcctactactactcctcctcctccaccagtggttggagattgatg |
150 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41094148 |
ggtcctcctactactactcctcctcctccaccagtggttggagattgatg |
41094099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University