View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_16 (Length: 202)
Name: NF0450_low_16
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0450_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 40484377 - 40484497
Alignment:
Q |
1 |
ccataccactcttaaaggatcttctgtgatgtcttctttatcatttttggtttgcgnnnnnnntctcaaagatatgtgtctacattgacacttgaatgta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
40484377 |
ccataccactcttaaaggatcttctgtgatgtcttctttatcatttttggtttgcgaaaaaaatctcaaagatatgtgtctacattgacacttgaatgta |
40484476 |
T |
 |
Q |
101 |
tcatgctcttcattctgtgct |
121 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
40484477 |
tcatgctcttcattctgtgct |
40484497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University