View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_3 (Length: 383)
Name: NF0450_low_3
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0450_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 15 - 364
Target Start/End: Complemental strand, 52926429 - 52926080
Alignment:
| Q |
15 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926429 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
52926330 |
T |
 |
| Q |
115 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926329 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
52926230 |
T |
 |
| Q |
215 |
actcagtactgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggttgtcttgttcaacttgctattgaagtt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52926229 |
actcagtactgttgctgctgaaaccaacccacaggatgctcccgttccaccctgcatttccactcttgaaggtggtcttgttcaacttgctattgaagtt |
52926130 |
T |
 |
| Q |
315 |
gaggatcgtgctcacccctccgcaatcaccagagtaaatgctgatgatgt |
364 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52926129 |
gaagatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgt |
52926080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University