View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_4 (Length: 373)
Name: NF0450_low_4
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0450_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 226 - 361
Target Start/End: Original strand, 2685140 - 2685272
Alignment:
| Q |
226 |
tttgagttgtgcatccatgccatggagtgtttcattagacaaaaagttttaaattttaatcacattattcaatcaaccaaaatgcatatgcaccaaaaca |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2685140 |
tttgagttgtgcatccatgccatggagtgtttcattagacaaaaagttttaaattttaatcacatt---caatcaaccaaaatgcatatgcaccaaaaca |
2685236 |
T |
 |
| Q |
326 |
tagtagaaagaaacaataacaaaaacgtacctagct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2685237 |
tagtagaaagaaacaataacaaaaacgtacctagct |
2685272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 33 - 159
Target Start/End: Original strand, 2685009 - 2685135
Alignment:
| Q |
33 |
tagacatcgttccttcacccttctaaggaaacatcaaatattttaggaagtacgaatattgtatcaacaaagtatgttttgaaacaccaactagagctac |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2685009 |
tagacaccgttccttcacccttctaaggaaacatcaaatattttaggaagtacgaatattgtatcaacaaagtatgttttgaaaaaccaaatagagctac |
2685108 |
T |
 |
| Q |
133 |
atttaatcgaaagatatattctcctaa |
159 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2685109 |
atttaatcgaaagatatattctcctaa |
2685135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University