View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_6 (Length: 315)
Name: NF0450_low_6
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0450_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 16 - 157
Target Start/End: Original strand, 52926080 - 52926221
Alignment:
| Q |
16 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926080 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
52926179 |
T |
 |
| Q |
116 |
gtggaacgggagcatcctgtgggttggtttcagcagcaacag |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926180 |
gtggaacgggagcatcctgtgggttggtttcagcagcaacag |
52926221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
| Q |
255 |
cttcattcattcaatttaataaataatacatcggacaacac |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33548952 |
cttcattcattcaatttaataaataatacatcggacaacac |
33548912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University