View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451Ase1 (Length: 80)
Name: NF0451Ase1
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0451Ase1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 10 - 76
Target Start/End: Complemental strand, 4712005 - 4711939
Alignment:
Q |
10 |
ttgttgcatgcaaacttgggaggaagagtatgccagtgccagctaattctactttatccaccgaatt |
76 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4712005 |
ttgttgcatgcaaacttgggaggaagagtatgccagtgccagctaattctactttatccaccgaatt |
4711939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1510 times since January 2019
Visitors: 3231