View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0451Ase1 (Length: 80)

Name: NF0451Ase1
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0451Ase1
NF0451Ase1
[»] chr5 (1 HSPs)
chr5 (10-76)||(4711939-4712005)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 10 - 76
Target Start/End: Complemental strand, 4712005 - 4711939
Alignment:
10 ttgttgcatgcaaacttgggaggaagagtatgccagtgccagctaattctactttatccaccgaatt 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4712005 ttgttgcatgcaaacttgggaggaagagtatgccagtgccagctaattctactttatccaccgaatt 4711939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1510 times since January 2019
Visitors: 3231