View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451Ase2 (Length: 255)
Name: NF0451Ase2
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0451Ase2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 16699519 - 16699289
Alignment:
| Q |
7 |
taatgagtttaattttattccttttttacaaataacattttagctgagtttgatttgtgttcataagagtaagagaaagccaaatgcttaaatattgatc |
106 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16699519 |
taatgagtttaattttattcctttcttacaaataacattttagctgagtttgatttgtgttcataagagtaagag------------ttaaatattgatc |
16699432 |
T |
 |
| Q |
107 |
cacataatatgaattgaattcttatcaacaaatcaattagtg-aaaaattggaactgaagctcctttgtcttcttacaaacactcaacaaaatcatcaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16699431 |
cacataatatgaattgaattcttatcaactaatcaattagtggaaaaattggaactgaagctcctttgtcttcttacaaacactcaacaaaatcatcaaa |
16699332 |
T |
 |
| Q |
206 |
ctcgtcgatagcacttccggtaacttaactaatgccctcttac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16699331 |
ctcgtcgatagcacttccggtaacttaactaatgccctcttac |
16699289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University