View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451Ase23 (Length: 87)
Name: NF0451Ase23
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0451Ase23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 4e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 35350954 - 35351028
Alignment:
| Q |
7 |
atcaaccacaaattttcaggtgttcaaatctacatgtagttaaacacttgacaattgtggttaatgaagttatta |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350954 |
atcaaccacaaattttcaggtgttcaaatctacatgtagttaaacacttgacaattgtggttaatgaagttatta |
35351028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 2932222 - 2932260
Alignment:
| Q |
19 |
ttttcaggtgttcaaatctacatgtagttaaacacttga |
57 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2932222 |
ttttcaggtgttcaaatctacatgtatttgaacacttga |
2932260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 27670306 - 27670343
Alignment:
| Q |
16 |
aaattttcaggtgttcaaatctacatgtagttaaacac |
53 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
27670306 |
aaattttcatgtgttcaaatctacatgtagttgaacac |
27670343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 30044669 - 30044634
Alignment:
| Q |
17 |
aattttcaggtgttcaaatctacatgtagttaaaca |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| |
|
|
| T |
30044669 |
aattttgaggtgttcaaatctacatgtagttgaaca |
30044634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University