View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451Ase3 (Length: 314)
Name: NF0451Ase3
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0451Ase3 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 308
Target Start/End: Original strand, 24487663 - 24487962
Alignment:
Q |
8 |
gttgattgtggtcggtttaatttataagaaaaaattgcgtaataatctcaactaacatataaattgtccttaatcatatatcataattagtttnnnnnnn |
107 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
T |
24487663 |
gttgattgtggtcggtttaatttataaggaaaaattgcataataatctcaactaacatataaattgtctttaatcatatgtcataattagtt--aaaaaa |
24487760 |
T |
|
Q |
108 |
nttaaatcgaatcataatccagaagatcctccatcaataatggagcaaatccaggagcttgaggagaactcaatgttcatattgttgaacggattgtgga |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| || |||||||||||||||||||||||||||| |||||||||| |
|
|
T |
24487761 |
attaaatcgaatcataatccagaagatcctccatcaattatggagcaaatctaggagtttaaggagaactcaatgttcatattgttgaatggattgtgga |
24487860 |
T |
|
Q |
208 |
gatgagcccattgttgagaccaactgcttaaataa-tttttagtgggtttcaaattgttttgagaaagatgaagcattgttaaatcaaaattgtaggaat |
306 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24487861 |
gatgagcccattgttgagaccaactgcttaaataattttttagtgggtttcaaattgtttcgagaaagatgaagcattgttaaatcaaaattgtaggaat |
24487960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2657 times since January 2019
Visitors: 8721