View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451Ase4 (Length: 294)
Name: NF0451Ase4
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0451Ase4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 288
Target Start/End: Complemental strand, 3138340 - 3138064
Alignment:
| Q |
8 |
gaaaagagttggatcagtgtaagagttgataaacttatattctttcttcccccttataattaacgctccccaccatctcccattattttatctatctata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3138340 |
gaaaagagttggatcagtgtaagagttgataaacttatattctttcttccctcttctaattaacgctccccaccatctcccattattttatctatctat- |
3138242 |
T |
|
| Q |
108 |
tatcttcattcttaaaccattcaaatgcgagattagagagaagatattatatgtatatagacatttataaatgtcaacctatacgtccccttgtagcatg |
207 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3138241 |
---cttctgtcttaaaccattcaaatgcgagattagagagaagatattatatgtatatagacatttataaatgtcaacctatacgtccccttgtagcatg |
3138145 |
T |
|
| Q |
208 |
tgtgatggtgagtgtggcttccacacgggtccacaaaatcatataatcataagttgggtaaatggtgatactatgacatta |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3138144 |
tgtgatggtgagtgtggcttccacatgggtccacaaaatcatctaatcataagttaggtaaatggtgatactatgacatta |
3138064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1370 times since January 2019
Visitors: 3228