View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451_high_3 (Length: 315)
Name: NF0451_high_3
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0451_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 12 - 187
Target Start/End: Original strand, 5256177 - 5256352
Alignment:
Q |
12 |
ataggggatcgaaactaaatgaatttaacaatcattttgcactctttgtttttacaatgaacacaatatcgatatgaagctattttcctatagtgttttc |
111 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5256177 |
ataggggatcgaaactcaatgaatttaacaatcattttgcgctctttgtttttacaatgaacacaatatcgatatgaagctattttcctatagtgttttg |
5256276 |
T |
 |
Q |
112 |
tttttactgggaacaattcatttgctaaatagtattcatcaattacattaggtgatagatgtttcaatatcaataa |
187 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
T |
5256277 |
tttttactgggaacaattcatttgctaaatagtattcatcaattacattatgtgctagatgtttcaaaatcaataa |
5256352 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 198 - 238
Target Start/End: Original strand, 5256373 - 5256413
Alignment:
Q |
198 |
tactatataccttatatcatcttcaatataggaactttgtg |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5256373 |
tactatataccttatatcatcttcaatataggaactttgtg |
5256413 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 106 - 136
Target Start/End: Original strand, 5256045 - 5256075
Alignment:
Q |
106 |
gttttctttttactgggaacaattcatttgc |
136 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
5256045 |
gttttctttttactgggaacaattcatttgc |
5256075 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University