View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0451_high_4 (Length: 262)

Name: NF0451_high_4
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0451_high_4
NF0451_high_4
[»] chr4 (1 HSPs)
chr4 (30-259)||(25703783-25704002)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 259
Target Start/End: Original strand, 25703783 - 25704002
Alignment:
30 tgtcattcaatgaaaaacgtaaacaaaactcaaaggtgcaaaggtttttcggagagaagataatattttgagggtnnnnnnnnnnnnnnnnnnnnnngtt 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||                      |||    
25703783 tgtcattcaatgaaaaacgtaaacaaaactcaaaggtgcaaaggtttttcggagagaaggtaatattttgagggtttgtgttgtgtg----------gtt 25703872  T
130 gaagagaatggaatgaaaaattaggagacaattttaggggatgtgtatatatatagtgagaggtggaggaatgggagagttattacagaggacacgtggt 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||    
25703873 gaagagaatggaatgaaaaattaggagacaattttaggggatgtgtatatatatagtgagaggtggaggaatggaagagttattagagaggacacgtggt 25703972  T
230 ggggggaccgtgaaccggttgaaccggtaa 259  Q
    ||||||||||||||||||||||||||||||    
25703973 ggggggaccgtgaaccggttgaaccggtaa 25704002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1797 times since January 2019
Visitors: 3237