View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451_high_4 (Length: 262)
Name: NF0451_high_4
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0451_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 259
Target Start/End: Original strand, 25703783 - 25704002
Alignment:
| Q |
30 |
tgtcattcaatgaaaaacgtaaacaaaactcaaaggtgcaaaggtttttcggagagaagataatattttgagggtnnnnnnnnnnnnnnnnnnnnnngtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
25703783 |
tgtcattcaatgaaaaacgtaaacaaaactcaaaggtgcaaaggtttttcggagagaaggtaatattttgagggtttgtgttgtgtg----------gtt |
25703872 |
T |
|
| Q |
130 |
gaagagaatggaatgaaaaattaggagacaattttaggggatgtgtatatatatagtgagaggtggaggaatgggagagttattacagaggacacgtggt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
25703873 |
gaagagaatggaatgaaaaattaggagacaattttaggggatgtgtatatatatagtgagaggtggaggaatggaagagttattagagaggacacgtggt |
25703972 |
T |
|
| Q |
230 |
ggggggaccgtgaaccggttgaaccggtaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25703973 |
ggggggaccgtgaaccggttgaaccggtaa |
25704002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1797 times since January 2019
Visitors: 3237