View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0451_low_12 (Length: 229)
Name: NF0451_low_12
Description: NF0451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0451_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 28673371 - 28673198
Alignment:
Q |
1 |
tgatgcaaaatacaaacatcataagagggaatgatttttccacactttcacatttctnnnnnnnctacacctgatttcataagtgaactttcacatgata |
100 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
T |
28673371 |
tgatgcaaaataccaacatcataagagggaatgatttttccacactttcacatttctaaaaaaactacacctgatatcataagtgaactttcacatgata |
28673272 |
T |
 |
Q |
101 |
taatttatctggttatcatttctcttagtgcataatgtctaaaattgtatcaaagatcgtatacatcgtacatg |
174 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
28673271 |
taatttatctggttatcatttctcttagtgcataatgtctaaaatcgtatcaaagatcgtatacatcgtacatg |
28673198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 1971439 - 1971487
Alignment:
Q |
171 |
catggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1971439 |
catggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
1971487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 219
Target Start/End: Original strand, 19962451 - 19962499
Alignment:
Q |
171 |
catggcggcatcaattttggtcgttttgtctccgctgcaaccgtctctg |
219 |
Q |
|
|
|||||||||| ||| ||||||||||||||||| ||||||||||||||| |
|
|
T |
19962451 |
catggcggcaccaactttggtcgttttgtctctactgcaaccgtctctg |
19962499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University