View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0452_low_11 (Length: 231)
Name: NF0452_low_11
Description: NF0452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0452_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 3 - 149
Target Start/End: Complemental strand, 15525151 - 15525005
Alignment:
| Q |
3 |
ttcttgaataattgaacaaacgcttgttgcatctcgcagcatgttattgttgatttgaatctgcggatacaacacctaagtcaagcactacagcaggtac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15525151 |
ttcttgaataattgaacaaacgcttgttgcatctcgcagcatgttattgttgatttgaatctgcggatacaacacctaagtcaagcactacagcaggtac |
15525052 |
T |
 |
| Q |
103 |
ttgatctagaatcggaggatatacctcttacgagggatgtgatgatg |
149 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15525051 |
ttgatctagaaacggaggatatacctcttacgagggatgtgatgatg |
15525005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 9 - 88
Target Start/End: Complemental strand, 15544707 - 15544628
Alignment:
| Q |
9 |
aataattgaacaaacgcttgttgcatctcgcagcatgttattgttgatttgaatctgcggatacaacacctaagtcaagc |
88 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||| |||||||| | ||||| || || |||||||||||| |
|
|
| T |
15544707 |
aataattgaacaaaagcttgttgcatcttgcagcatgttattgatgatttgagccagcggacacgacgcctaagtcaagc |
15544628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University