View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0452_low_13 (Length: 222)
Name: NF0452_low_13
Description: NF0452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0452_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 26891053 - 26891200
Alignment:
Q |
1 |
ttaggtgtaaatatcacaaatctagcagaatgtgctatatgtgcatgtaaatatgtattcgggaagagaaagaaatgcaaatatcataattgaatgttta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26891053 |
ttaggtgtaaatatcacaaatctagcagaatgtgctatatgtgcatgtaaatatgtattcgggaagagaaagaaatgcaaatatcataattgaatgtttg |
26891152 |
T |
 |
Q |
101 |
tgttaagaaaaatactatttctcgcgacagattccttcccgagagtgt |
148 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
26891153 |
tgttaagaaaaatgctatttctcgcgacagattccttcccgagagtgt |
26891200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 147
Target Start/End: Original strand, 12072659 - 12072700
Alignment:
Q |
106 |
agaaaaatactatttctcgcgacagattccttcccgagagtg |
147 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||||| |
|
|
T |
12072659 |
agaaaaatgctatttctcgcgacagtttccttcccgagagtg |
12072700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 131 times since January 2019
Visitors: 3248