View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0452_low_17 (Length: 204)
Name: NF0452_low_17
Description: NF0452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0452_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 6e-30; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 1760066 - 1760136
Alignment:
Q |
1 |
caaagagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttcacagg |
71 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
1760066 |
caaagagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttactacttcacagg |
1760136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 3 - 69
Target Start/End: Original strand, 1744360 - 1744426
Alignment:
Q |
3 |
aagagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttcaca |
69 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
T |
1744360 |
aagagaaaaaaatggattcaaggtctttttcatgcttattttgcaagggaaaattttctacttcaca |
1744426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 1724448 - 1724496
Alignment:
Q |
23 |
aggtctttttcatgtttattttgcaagagaaaatttgctacttcacagg |
71 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
T |
1724448 |
aggtctttttcatgcttattttgcaagagaaaattttctacttcacagg |
1724496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 66
Target Start/End: Original strand, 1739019 - 1739080
Alignment:
Q |
5 |
gagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttc |
66 |
Q |
|
|
|||||||| ||||||||||| |||||||||| |||||||||||| |||||||| ||||||| |
|
|
T |
1739019 |
gagaaaaaaatggattcaaggactttttcatgcttattttgcaagggaaaattttctacttc |
1739080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 66
Target Start/End: Original strand, 2022788 - 2022851
Alignment:
Q |
3 |
aagagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttc |
66 |
Q |
|
|
||||||| |||| ||||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
T |
2022788 |
aagagaagaattcagattcaaagtctttttcatgttgtttttgcaagagaaaattttctacttc |
2022851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 3 - 69
Target Start/End: Complemental strand, 3157034 - 3156968
Alignment:
Q |
3 |
aagagaaaaatttggattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttcaca |
69 |
Q |
|
|
||||||| |||| ||||||||||||||||||||| | ||||| |||||| ||||| |||||||||| |
|
|
T |
3157034 |
aagagaagaattcggattcaaggtctttttcatgctccttttgtaagagacaattttctacttcaca |
3156968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 3167250 - 3167302
Alignment:
Q |
17 |
gattcaaggtctttttcatgtttattttgcaagagaaaatttgctacttcaca |
69 |
Q |
|
|
||||||| |||||||||||||| |||||||||||||||||| |||| ||||| |
|
|
T |
3167250 |
gattcaaagtctttttcatgttgtttttgcaagagaaaattttctacatcaca |
3167302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University