View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0452_low_8 (Length: 257)
Name: NF0452_low_8
Description: NF0452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0452_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 23152177 - 23152074
Alignment:
| Q |
1 |
ttgcactttgctgatactcctgactctgtttgcagttacaacaacaacagtaagcaacaaccatcatttatactctcttatcattgttttatgttcatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| | | |||||| |||| |||||||||||||||||||| | |
|
|
| T |
23152177 |
ttgcactttgctgatactcctgactctgtttgcagttacaataacaaaagtaagcagcaacaaacttttatattctcctatcattgttttatgttcattt |
23152078 |
T |
|
| Q |
101 |
cact |
104 |
Q |
| |
|
|||| |
|
|
| T |
23152077 |
cact |
23152074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1324 times since January 2019
Visitors: 3228