View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0453_high_10 (Length: 251)
Name: NF0453_high_10
Description: NF0453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0453_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 58 - 238
Target Start/End: Original strand, 42983408 - 42983588
Alignment:
| Q |
58 |
gatgatagagatggaagagaggatttgaagaaggtggaaaagactccatggaaatggaaattcaaagtaaagtgaggaaactcacataacacnnnnnnnn |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983408 |
gatgatagagatggaagagaggatttgaagaaggtggagaagactccatggaaatggaaattcaaagtaaagtgaggaaactcacataacacaaaaagaa |
42983507 |
T |
|
| Q |
158 |
nnnnngattttttgagaggaaatatatattctatactccaagttaggcggtttttaaggttctgttttccctctctctcct |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983508 |
aaaaagattttttgagaggaaatagatattctatactccaagttaggcggtttttaaggttctgttttccctctctctcct |
42983588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 42636039 - 42636094
Alignment:
| Q |
1 |
aattgaagtaaatcagtgcattggcgatgcatgtgatacaatgctatgcaagtaat |
56 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
42636039 |
aattgaagtaaatcagtgcattggtgatgcatgtgatacgatgctatgcaagtaat |
42636094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 51
Target Start/End: Original strand, 49601162 - 49601203
Alignment:
| Q |
10 |
aaatcagtgcattggcgatgcatgtgatacaatgctatgcaa |
51 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
49601162 |
aaatcagtgcattggtgatgtatgtgattcaatgctatgcaa |
49601203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 317 times since January 2019
Visitors: 3263