View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0453_low_15 (Length: 236)
Name: NF0453_low_15
Description: NF0453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0453_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 37253798 - 37253945
Alignment:
| Q |
1 |
ctcagcacatcgtacatcaatctattgcgagctcggtggatcaaggacacatcaggttgttcttcatgggataattttcttccatatttttgccatggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37253798 |
ctcagcacatcgtacatcaatctattgcgagctcggtggatcaaggacacatcaggttgttcttcatgggataatcttcttccatatttttgccatggct |
37253897 |
T |
 |
| Q |
101 |
ctgcaacaataattcaatttctgcaagcgcataacttggcaactgatg |
148 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
37253898 |
ctgcaacaataattcaatttctgccggcgcataactttgcaactgatg |
37253945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 11073320 - 11073463
Alignment:
| Q |
1 |
ctcagcacatcgtacatcaatctattgcgagctcggtggatcaaggacacatcaggttgttcttcatgggataattttcttccatatttttgccatggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11073320 |
ctcagcacatcgtacatcaatctattgcgagctcggtggatcaaggacacatcaggttgttcttcatgggataatcttcttccatatttttaccatggct |
11073419 |
T |
 |
| Q |
101 |
ctgcaacaataattcaatttctgcaagcgcataacttggcaact |
144 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
11073420 |
ctgcaacaataattcaatttcttccagcgcataactttgcaact |
11073463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 45091372 - 45091226
Alignment:
| Q |
1 |
ctcagcacatcgtacatcaatctattgcgagctcggtggatcaaggacacatcaggttgttcttcatgggataattttcttccatatttttgccatggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45091372 |
ctcagcacatcgtacatcaatctattgcgagcttggtggatcaagga-acatcatgttgttcttcatgagataattttcttccatatttttgccatggct |
45091274 |
T |
 |
| Q |
101 |
ctgcaacaataattcaatttctgcaagcgcataacttggcaactgatg |
148 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
45091273 |
ctgcaacaataattcaatttccgccagcgcataactttgcaactgatg |
45091226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University