View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0453_low_19 (Length: 206)
Name: NF0453_low_19
Description: NF0453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0453_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 38883946 - 38884110
Alignment:
| Q |
1 |
taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883946 |
taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt |
38884045 |
T |
 |
| Q |
101 |
tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgatgatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38884046 |
tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgatgatg |
38884110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 38893138 - 38893298
Alignment:
| Q |
1 |
taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt |
100 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||| ||||||||||||||||| || ||||| || ||||||||||| |||||| ||||||| |||| |
|
|
| T |
38893138 |
taccatgttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttt |
38893237 |
T |
 |
| Q |
101 |
tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgat |
161 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| ||||| ||||||||||| || ||||| |
|
|
| T |
38893238 |
tctttggctggcttggtgataagttgggtaggaagaaagtgtatggtatgacactgatgat |
38893298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 34 - 147
Target Start/End: Complemental strand, 37316106 - 37315993
Alignment:
| Q |
34 |
ttgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagga |
133 |
Q |
| |
|
|||||||| ||||||||||| || || |||||||| ||| ||||||| || || |||| |||||||||||||| |||||||| || || ||||| || | |
|
|
| T |
37316106 |
ttgcctccaaatgtatcagcagcagtaaatggtgttgctctctgtggcactctagcaggccaacttttctttggttggcttggggacaaaatgggaagaa |
37316007 |
T |
 |
| Q |
134 |
aaaaagtctatggt |
147 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
37316006 |
aaaaagtttatggt |
37315993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 61 - 155
Target Start/End: Original strand, 33115133 - 33115227
Alignment:
| Q |
61 |
aatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccct |
155 |
Q |
| |
|
|||||||| |||||| ||||| |||| |||| |||||||||||||| ||||||||||| || ||||| || ||| ||| ||||| |||||||| |
|
|
| T |
33115133 |
aatggtgttgctttcagtggagcactggcaggacaacttttctttggttggcttggtgacaaaatgggaagaaaacgagtttatggaatgaccct |
33115227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University