View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0453_low_19 (Length: 206)

Name: NF0453_low_19
Description: NF0453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0453_low_19
NF0453_low_19
[»] chr7 (2 HSPs)
chr7 (1-165)||(38883946-38884110)
chr7 (1-161)||(38893138-38893298)
[»] chr3 (1 HSPs)
chr3 (34-147)||(37315993-37316106)
[»] chr1 (1 HSPs)
chr1 (61-155)||(33115133-33115227)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 38883946 - 38884110
Alignment:
1 taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883946 taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt 38884045  T
101 tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgatgatg 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38884046 tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgatgatg 38884110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 38893138 - 38893298
Alignment:
1 taccacgttgatggtgctgcgaagcccggtacattgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttt 100  Q
    ||||| ||||||||||| | |||||||||||||||||| ||||||||||||||||| || ||||| || ||||||||||| |||||| ||||||| ||||    
38893138 taccatgttgatggtgccgggaagcccggtacattgccacccaatgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttt 38893237  T
101 tctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccctcatgat 161  Q
    ||||||||||||||||||||||| |||| ||||| ||||| ||||||||||| || |||||    
38893238 tctttggctggcttggtgataagttgggtaggaagaaagtgtatggtatgacactgatgat 38893298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 34 - 147
Target Start/End: Complemental strand, 37316106 - 37315993
Alignment:
34 ttgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagga 133  Q
    |||||||| ||||||||||| || || |||||||| ||| ||||||| || ||  |||| |||||||||||||| |||||||| || || ||||| || |    
37316106 ttgcctccaaatgtatcagcagcagtaaatggtgttgctctctgtggcactctagcaggccaacttttctttggttggcttggggacaaaatgggaagaa 37316007  T
134 aaaaagtctatggt 147  Q
    ||||||| ||||||    
37316006 aaaaagtttatggt 37315993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 61 - 155
Target Start/End: Original strand, 33115133 - 33115227
Alignment:
61 aatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccct 155  Q
    |||||||| |||||| ||||| ||||  |||| |||||||||||||| ||||||||||| || ||||| || |||  ||| ||||| ||||||||    
33115133 aatggtgttgctttcagtggagcactggcaggacaacttttctttggttggcttggtgacaaaatgggaagaaaacgagtttatggaatgaccct 33115227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University