View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0453_low_7 (Length: 291)
Name: NF0453_low_7
Description: NF0453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0453_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 32 - 193
Target Start/End: Complemental strand, 30409443 - 30409284
Alignment:
| Q |
32 |
gcacagactgactagttgggaatgggaagtgtatggttttcgttaagctaagccccctttgaatttgagttaaaagaaaacatctaaactctaaacacaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409443 |
gcacagactgactagttgggaatgggaagtgtatggttttcgttaagctaagccc--tttgaatttgagttaaaagaaaacatctaaactctaaacacaa |
30409346 |
T |
 |
| Q |
132 |
taaagtgttgcgttatttgaatatcaaaatacatacatcacattatgcagaggggtcatatc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30409345 |
taaagtgttgcgttatttgaatatcaaaatacatacatcacattatgcagaggggtcatatc |
30409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 89 - 135
Target Start/End: Complemental strand, 30411898 - 30411848
Alignment:
| Q |
89 |
tttgaatttgagttaaaa----gaaaacatctaaactctaaacacaataaa |
135 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
30411898 |
tttgaatttgagttaaaatatagaaaacatctaaactctaaatacaataaa |
30411848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University