View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0454_low_11 (Length: 286)
Name: NF0454_low_11
Description: NF0454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0454_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 104 - 251
Target Start/End: Original strand, 1887688 - 1887835
Alignment:
| Q |
104 |
gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctagtttgctatattta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1887688 |
gggtaaacaaatttttggcgtgatcgttcctcttctctttatcttgttctttggttatgattatgaattagctatacatctagctaggttgctatattta |
1887787 |
T |
 |
| Q |
204 |
ctaatattgattatttttgcttggactgttttaatttgttggttgcct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1887788 |
ctaatattgattatttttgcttggactgttttaatttgttggttgcct |
1887835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University