View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0454_low_9 (Length: 317)
Name: NF0454_low_9
Description: NF0454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0454_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 34 - 230
Target Start/End: Original strand, 37089549 - 37089745
Alignment:
Q |
34 |
gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37089549 |
gagaggatgaaatctatgagtactggtctttttctatgtacactttcaatgggatattttgttagtagtttattggtttcaattgtggacaaagtaagca |
37089648 |
T |
 |
Q |
134 |
agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct |
230 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37089649 |
agaaaagatggttgaagagtaatcttgataagggtaagttagattacttctattggttactagcaattcttggagtgctgaattttgtactttttct |
37089745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1893 times since January 2019
Visitors: 3241