View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_high_26 (Length: 255)
Name: NF0455_high_26
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0455_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 1887725 - 1887968
Alignment:
Q |
1 |
tttatcttgttctttggttatgattatgaattagctatacatctagctagtttgctatatttactaatattgattatttttgcttggactgttttaattt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1887725 |
tttatcttgttctttggttatgattatgaattagctatacatctagctaggttgctatatttactaatattgattatttttgcttggactgttttaattt |
1887824 |
T |
 |
Q |
101 |
gttggttgcctttgttatttgctccacgcatcgtgtcatttgttctaattcacaacactttacaagtacttgtttcttcatttcttcttatttaatgaga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1887825 |
gttggttgcctttgttatttgctccacgcatcgtgtcatttgttctaattcacaacactttacaagtacttgtttcttcatttcttcttatttaatgaga |
1887924 |
T |
 |
Q |
201 |
gcttaataattttagttctaaagagttttagtttctatattcat |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1887925 |
gcttaataattttagttctaaagagttttagtttctatattcat |
1887968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1630 times since January 2019
Visitors: 3233