View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_12 (Length: 400)
Name: NF0455_low_12
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0455_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 121 - 275
Target Start/End: Complemental strand, 38630261 - 38630107
Alignment:
Q |
121 |
atgtcttctccatttttctttctatacaaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgc |
220 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38630261 |
atgtcttctccatttttctttctataccaaatacttgttattctcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgc |
38630162 |
T |
 |
Q |
221 |
tacggcatctattcattgatagtgaaaaccaaaatcaatattcttcacaggttct |
275 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
38630161 |
tacggcatctattcattgatagtgaaaaccaaaatcaatattcttcacagattct |
38630107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 164 - 247
Target Start/End: Original strand, 38695745 - 38695825
Alignment:
Q |
164 |
tcactaatgtatcttgtctataggtatatctgcatggcgctagttcacataccttgctacggcatctattcattgatagtgaaa |
247 |
Q |
|
|
|||| |||| ||| |||||||||| |||||| | ||||||||||||||||| ||||||| ||| |||| ||||||||||||| |
|
|
T |
38695745 |
tcaccaatgcatcgtgtctatagg---atctgccttgcgctagttcacataccctgctacgacatgtatttattgatagtgaaa |
38695825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1796 times since January 2019
Visitors: 3237