View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0455_low_13 (Length: 399)

Name: NF0455_low_13
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0455_low_13
NF0455_low_13
[»] scaffold0440 (1 HSPs)
scaffold0440 (317-367)||(14378-14428)
[»] chr8 (1 HSPs)
chr8 (317-364)||(25456833-25456880)


Alignment Details
Target: scaffold0440 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0440
Description:

Target: scaffold0440; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 317 - 367
Target Start/End: Original strand, 14378 - 14428
Alignment:
317 atatcacgcatacaaaactcaatttctcaatcgactaagctggatgagcag 367  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
14378 atatcacgcatacaaaactcaatttctcaatcgactaagctggatgagcag 14428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 317 - 364
Target Start/End: Complemental strand, 25456880 - 25456833
Alignment:
317 atatcacgcatacaaaactcaatttctcaatcgactaagctggatgag 364  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||    
25456880 atatcacgcatacaaaactcaatttctcattcgactaagctggatgag 25456833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1873 times since January 2019
Visitors: 3241