View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_13 (Length: 399)
Name: NF0455_low_13
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0455_low_13 |
 |  |
|
[»] scaffold0440 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0440 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0440
Description:
Target: scaffold0440; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 317 - 367
Target Start/End: Original strand, 14378 - 14428
Alignment:
Q |
317 |
atatcacgcatacaaaactcaatttctcaatcgactaagctggatgagcag |
367 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14378 |
atatcacgcatacaaaactcaatttctcaatcgactaagctggatgagcag |
14428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 317 - 364
Target Start/End: Complemental strand, 25456880 - 25456833
Alignment:
Q |
317 |
atatcacgcatacaaaactcaatttctcaatcgactaagctggatgag |
364 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
25456880 |
atatcacgcatacaaaactcaatttctcattcgactaagctggatgag |
25456833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1873 times since January 2019
Visitors: 3241