View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_17 (Length: 362)
Name: NF0455_low_17
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 265 - 359
Target Start/End: Original strand, 36446387 - 36446479
Alignment:
| Q |
265 |
gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtggaacctatgatactac |
359 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36446387 |
gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatgatactac |
36446479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 38 - 128
Target Start/End: Original strand, 36446189 - 36446279
Alignment:
| Q |
38 |
tacttatgatactccctatccctatactattgattatatgatgtacttggttcaactcttatcnnnnnnnncttagataatttaagtttgg |
128 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
36446189 |
tacttatgatactccctatacccatactattgattatatgatctacttggtttaactcttatcttttttatcttagataatttaagtttgg |
36446279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 7 - 42
Target Start/End: Complemental strand, 38630261 - 38630226
Alignment:
| Q |
7 |
atgtcttctccatttttctttctatacaaaatactt |
42 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38630261 |
atgtcttctccatttttctttctataccaaatactt |
38630226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University