View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0455_low_17 (Length: 362)

Name: NF0455_low_17
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0455_low_17
NF0455_low_17
[»] chr7 (2 HSPs)
chr7 (265-359)||(36446387-36446479)
chr7 (38-128)||(36446189-36446279)
[»] chr1 (1 HSPs)
chr1 (7-42)||(38630226-38630261)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 265 - 359
Target Start/End: Original strand, 36446387 - 36446479
Alignment:
265 gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtggaacctatgatactac 359  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36446387 gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatgatactac 36446479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 38 - 128
Target Start/End: Original strand, 36446189 - 36446279
Alignment:
38 tacttatgatactccctatccctatactattgattatatgatgtacttggttcaactcttatcnnnnnnnncttagataatttaagtttgg 128  Q
    ||||||||||||||||||| || ||||||||||||||||||| ||||||||| ||||||||||        ||||||||||||||||||||    
36446189 tacttatgatactccctatacccatactattgattatatgatctacttggtttaactcttatcttttttatcttagataatttaagtttgg 36446279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 7 - 42
Target Start/End: Complemental strand, 38630261 - 38630226
Alignment:
7 atgtcttctccatttttctttctatacaaaatactt 42  Q
    ||||||||||||||||||||||||||| ||||||||    
38630261 atgtcttctccatttttctttctataccaaatactt 38630226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University