View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_20 (Length: 333)
Name: NF0455_low_20
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_20 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 115 - 245
Target Start/End: Original strand, 6169395 - 6169525
Alignment:
| Q |
115 |
cggtatttaggctaaccgaaacggtccgagaagaacggttcccaaataacatcaggaagagcagtggaccaccaaacaccctgaatactctgaccatgag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169395 |
cggtatttaggctaaccgaaacggtccgaaaagaacggttcccgaataacatcaggaagagcagtggaccaccaaacaccctgaatactctgaccatgag |
6169494 |
T |
 |
| Q |
215 |
accgtccgcacagctattcctctaccggaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6169495 |
accgtccgcacagctattcctctaccggaat |
6169525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 14103303 - 14103209
Alignment:
| Q |
118 |
tatttaggctaaccgaaacggtccgagaagaacggttcccaaataacatcaggaagagcagtggaccaccaaacaccctgaatactctgaccatga |
213 |
Q |
| |
|
||||||||| ||||||||||||| || || ||||| |||| ||||||||| ||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
14103303 |
tatttaggccaaccgaaacggtctgaaaa-aacggatcccgaataacatctagaagagcagtggaccaccaaacaccctgagtactgtgaccatga |
14103209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 32879826 - 32879731
Alignment:
| Q |
118 |
tatttaggctaaccgaaacggtccgagaagaacggttcccaaataacatcaggaagagcagtggaccaccaaacaccctgaatactctgaccatga |
213 |
Q |
| |
|
||||||||| ||| ||||||||| || ||||||| || ||||| ||| |||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
32879826 |
tatttaggccaactgaaacggtctgaaaagaacgaaccctgaataaaatctggaagagcggtggaccaccaaacaccctgaatattgtgaccatga |
32879731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 118 - 211
Target Start/End: Complemental strand, 153393 - 153299
Alignment:
| Q |
118 |
tatttaggctaaccgaaacggtccgagaagaacggttcccaaataacatcaggaagagcagtggaccaccaa-acaccctgaatactctgaccat |
211 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| ||| ||||| || |||||| ||||||| |||||| ||| |||||||||| ||||||| |
|
|
| T |
153393 |
tatttaggctaaccgaaatggtctgaaaagaacggctcctgaataaaatatggaagaacagtggatcaccaacacatcctgaatactgtgaccat |
153299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University