View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_25 (Length: 301)
Name: NF0455_low_25
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 35973773 - 35973532
Alignment:
| Q |
1 |
tccactagatcgccgacagttgattccggcttcatcagcatctgaacgggaccaaggcttccaagaaccgtcactttcaaaagcaacttcggtggttgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973773 |
tccactagatcgccgacagttgattccggtttcatcagcatctgaataggaccaaggcttccaagaaccgtcactttcaaaagcaacttcggtggttgtc |
35973674 |
T |
 |
| Q |
101 |
taggaagaccttccgtcaccggaaggacgttgttccggtaagatagaagatcaggaacggtttttggacggcgaattgtagcagtggtcgtcataacgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973673 |
taggaagaccttccgtcaccggaaggacgttgttccggtaagatagaagatcaggaacggtttttggacggcgaattgtagcagtggtcgtcataacgtt |
35973574 |
T |
 |
| Q |
201 |
gtttccgtgaaaagatgaagatctgtcgctcaaccttctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35973573 |
gtttccgtgaaaagatgaagatctctcgctcaaccttctctg |
35973532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 287
Target Start/End: Complemental strand, 36253614 - 36253570
Alignment:
| Q |
243 |
ctcctcctcaaccttcttcaatcgctcctttgcactacctttgtc |
287 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36253614 |
ctcctcctcaaccttcttcgatcgctcctttgcactacctttgtc |
36253570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University