View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_29 (Length: 286)
Name: NF0455_low_29
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 64 - 243
Target Start/End: Complemental strand, 34072923 - 34072744
Alignment:
| Q |
64 |
aaaaacatcatgaaccaagaaacatgcaacaaaagtacttagatcataaacataatgcaaagtgttagaagaaagagaaagaagtacaaaccaagaagca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34072923 |
aaaaacatcatgaaccaagaaacatgcaacaaaagtacttagatcataaacataatgcaaagtgttagaagaaagagaaagaagtacaaaccaagaagca |
34072824 |
T |
|
| Q |
164 |
taagcaaaactgatgaaacaacaaagatgaagcaaaaccctcttgccattgttctctctatctctagattctctctgctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34072823 |
taagcaaaactgatgaaacaacaaagatgaagcaaaaccctcttgccattgttctctctatctctagattctcactgctc |
34072744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 68 - 106
Target Start/End: Complemental strand, 34072989 - 34072951
Alignment:
| Q |
68 |
acatcatgaaccaagaaacatgcaacaaaagtacttaga |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34072989 |
acatcatgaaacaagaaacatgcaacaaaagtacttaga |
34072951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1683 times since January 2019
Visitors: 3233