View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_31 (Length: 279)
Name: NF0455_low_31
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 36 - 241
Target Start/End: Original strand, 22492857 - 22493062
Alignment:
| Q |
36 |
cttgttttaattaattagtgatgagatgaggtttattgaattagtagtgaaaactaatttgtgtaaaatttatcttacttgtgcactgtaaacattagtt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22492857 |
cttgttttaattaattagtgatgagatgaggtttattgaattagtagtgaaaactaatttgtgtaaaatttatcttacttgtgcaccgtaaacattagtt |
22492956 |
T |
 |
| Q |
136 |
attaataatgttgtttcaaacgtaattgggttggtatagtggtattggcttgagacttgcgactgtacttctcttaaaagttttgaataaggttcgattc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22492957 |
attaataatgttgtttcaaacgtaattgggttggtatagtggtattggcttgagacttgcgactgtacttctcttaaaagttttgaataaggttcgattc |
22493056 |
T |
 |
| Q |
236 |
tctctg |
241 |
Q |
| |
|
|||||| |
|
|
| T |
22493057 |
tctctg |
22493062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University