View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_33 (Length: 277)
Name: NF0455_low_33
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0455_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 30 - 227
Target Start/End: Complemental strand, 8199250 - 8199053
Alignment:
Q |
30 |
ctttctagataatgattaaatgattgtgtgaaagtgtctttggggatgtttttggcatttttcagtccatgtttttaggccttgaagttggtttttaagt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8199250 |
ctttctagataatgattaaatgattgtgtgaaagtgtctttggggatgtttttggcatttttcagtccatgtttttaggccttgaagttggtttttaagt |
8199151 |
T |
 |
Q |
130 |
tggagtactagactgttatcgcatttatatttacttcaatttattcgttgttgacatctattttaagtctagccgtctagggtatctataaataaata |
227 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8199150 |
tggagtactagactgttttcgcatttatatttacttcaatttattcgttgttgacatctattttaagtctagccgtctagggtatctataaataaata |
8199053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 42356291 - 42356161
Alignment:
Q |
101 |
tttttaggccttgaagttggtttttaagttggagtac--tagactgttatcgcatttat---atttacttcaatttattcgttgttgacatctattttaa |
195 |
Q |
|
|
|||||||||||||||| || ||| ||||||||||||| |||| || | | |||||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
T |
42356291 |
tttttaggccttgaagatgttttataagttggagtacaatagaatggttttgcatttatcatatttacttcaatttattctttgttgacatgtattttag |
42356192 |
T |
 |
Q |
196 |
gtctagccgtctagggtatctataaataaat |
226 |
Q |
|
|
||||||||||||||||||||||||| ||||| |
|
|
T |
42356191 |
gtctagccgtctagggtatctataagtaaat |
42356161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1424 times since January 2019
Visitors: 3230