View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_35 (Length: 258)
Name: NF0455_low_35
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_35 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 49511109 - 49511337
Alignment:
| Q |
30 |
atcctggactctttattccttgtgaccagtttggatcatttttaacatgtgagaattgtatttgaacatgaattttggaaccgccttgtattggacgatg |
129 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49511109 |
atcctggactctttagtccttgtgaccagtttggatcatttttaacatgtgagaattgtatttgaacatgaattttggaaccgccttgtattggatgatg |
49511208 |
T |
|
| Q |
130 |
atctacatctaatatattaacccatgtattcactatgttgccctttatgacttgttcaactggaacataagctcttccaattagagttgctccaatgggg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511209 |
atctacatctaatatattaacccatgtattcactatgttgccctttatgacttgttcaactggaacataagctcttccaattagagttgctccaatgggg |
49511308 |
T |
|
| Q |
230 |
ttatcttgtttgacagtgaatataatgtt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49511309 |
ttatcttgtttgacagtgaatataatgtt |
49511337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 197 - 258
Target Start/End: Original strand, 49522226 - 49522287
Alignment:
| Q |
197 |
taagctcttccaattagagttgctccaatggggttatcttgtttgacagtgaatataatgtt |
258 |
Q |
| |
|
||||||||||| ||||||||||| ||||| || ||||| | |||||||||||||| |||||| |
|
|
| T |
49522226 |
taagctcttcctattagagttgcaccaatcggattatcatctttgacagtgaatacaatgtt |
49522287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 72 times since January 2019
Visitors: 3256