View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_41 (Length: 238)
Name: NF0455_low_41
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0455_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 12 - 135
Target Start/End: Original strand, 7308791 - 7308914
Alignment:
| Q |
12 |
agagatggtgagagagaatttgtggcggttggtggaggagagggactctttcgatacnnnnnnnagagggttttaataacggtcgcagtcggcggcgtcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
7308791 |
agagatggtgagagagaatttgtggcggttggtgaaggagaggaactctttcgatacggtggagagaggttttaaataacggtcgcagtcggcgtcgtcg |
7308890 |
T |
|
| Q |
112 |
ccgtcgaggagggggttgaagatg |
135 |
Q |
| |
|
|||||||||||| | ||||||||| |
|
|
| T |
7308891 |
ccgtcgaggaggagtttgaagatg |
7308914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1565 times since January 2019
Visitors: 3232