View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0455_low_42 (Length: 206)

Name: NF0455_low_42
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0455_low_42
NF0455_low_42
[»] chr5 (3 HSPs)
chr5 (35-206)||(40545760-40545931)
chr5 (42-144)||(31790151-31790253)
chr5 (42-100)||(32033461-32033519)
[»] chr3 (1 HSPs)
chr3 (35-204)||(5163014-5163181)


Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 35 - 206
Target Start/End: Original strand, 40545760 - 40545931
Alignment:
35 agaacctgtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcat 134  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
40545760 agaacctgtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcactcatagctctgattgcaccataattttgttgcttttgcat 40545859  T
135 ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaaat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40545860 ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaaat 40545931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 42 - 144
Target Start/End: Original strand, 31790151 - 31790253
Alignment:
42 gtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcatttggatt 141  Q
    ||||||||||||||| |||||||||||||||| || ||||  |||||||||||| |||||| | |||||| |  || |||||||||||||||||||||||    
31790151 gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcactaatagctataattgcaacgcaattttgttgcttttgcatttggatt 31790250  T
142 gaa 144  Q
    |||    
31790251 gaa 31790253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 100
Target Start/End: Original strand, 32033461 - 32033519
Alignment:
42 gtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatag 100  Q
    ||||||||||||||| |||||||||||||||| || ||||  |||||||||||| ||||    
32033461 gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcactaatag 32033519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 35 - 204
Target Start/End: Original strand, 5163014 - 5163181
Alignment:
35 agaacctgtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcat 134  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| || ||||||||||||||||    
5163014 agaacttgtgaccagattgaaaattttgttgctattagatttctgtttagttcgcttcactcatagctctgattacaccacaattttgttgcttttgcat 5163113  T
135 ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaa 204  Q
    ||||||||||||||||||||||||  |||||| |||||||||||||||||||||||||||||||||||||    
5163114 ttggattgaaccttcatgtttcct--tctgagttgtagtaatttattttcagaatttatgatttgataaa 5163181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 16 times since January 2019
Visitors: 3242