View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0455_low_42 (Length: 206)
Name: NF0455_low_42
Description: NF0455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0455_low_42 |
 |  |
|
[»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 35 - 206
Target Start/End: Original strand, 40545760 - 40545931
Alignment:
Q |
35 |
agaacctgtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcat |
134 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
40545760 |
agaacctgtgaccagattgaaaattttgttgctattagatttctgtttagttctcttcactcatagctctgattgcaccataattttgttgcttttgcat |
40545859 |
T |
 |
Q |
135 |
ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaaat |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40545860 |
ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaaat |
40545931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 42 - 144
Target Start/End: Original strand, 31790151 - 31790253
Alignment:
Q |
42 |
gtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcatttggatt |
141 |
Q |
|
|
||||||||||||||| |||||||||||||||| || |||| |||||||||||| |||||| | |||||| | || ||||||||||||||||||||||| |
|
|
T |
31790151 |
gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcactaatagctataattgcaacgcaattttgttgcttttgcatttggatt |
31790250 |
T |
 |
Q |
142 |
gaa |
144 |
Q |
|
|
||| |
|
|
T |
31790251 |
gaa |
31790253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 100
Target Start/End: Original strand, 32033461 - 32033519
Alignment:
Q |
42 |
gtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatag |
100 |
Q |
|
|
||||||||||||||| |||||||||||||||| || |||| |||||||||||| |||| |
|
|
T |
32033461 |
gtgaccagattgaaacttttgttgctattagatttttgttgtgttctcttcactaatag |
32033519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 35 - 204
Target Start/End: Original strand, 5163014 - 5163181
Alignment:
Q |
35 |
agaacctgtgaccagattgaaaattttgttgctattagacttctgtttagttctcttcactcatagctctgattgcaccataactttgttgcttttgcat |
134 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| || |||||||||||||||| |
|
|
T |
5163014 |
agaacttgtgaccagattgaaaattttgttgctattagatttctgtttagttcgcttcactcatagctctgattacaccacaattttgttgcttttgcat |
5163113 |
T |
 |
Q |
135 |
ttggattgaaccttcatgtttccttgtctgagctgtagtaatttattttcagaatttatgatttgataaa |
204 |
Q |
|
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
5163114 |
ttggattgaaccttcatgtttcct--tctgagttgtagtaatttattttcagaatttatgatttgataaa |
5163181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16 times since January 2019
Visitors: 3242