View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0456_high_16 (Length: 229)
Name: NF0456_high_16
Description: NF0456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0456_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 52 - 212
Target Start/End: Complemental strand, 10219407 - 10219245
Alignment:
| Q |
52 |
tgatgcaaggtttgtttggagtgatgaagtttctatggaattggagtggtgttggtgctgattctaaacgttctatgcttctgttgcttcctagacttaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10219407 |
tgatgcaaggtttgtttggagtgatgaagtttctatggaattggagtggtgttggtgctgattctaaacgttctatgcttcttttgcttcctagacttaa |
10219308 |
T |
|
| Q |
152 |
ttctcgtacttctctccatagttcttctatcttctcattcattct--cagatactatgttatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10219307 |
ttctcgtacttctctccatagttcttctatcttctcattcattctcacagatactatgttatt |
10219245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 100 - 195
Target Start/End: Original strand, 13853932 - 13854027
Alignment:
| Q |
100 |
gtgttggtgctgattctaaacgttctatgcttctgttgcttcctagacttaattctcgtacttctctccatagttcttctatcttctcattcattc |
195 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13853932 |
gtgttggtggagattctaaacgttctatggttctgttgcttcctaaacttaattctcgtacttctctccatagttcttctatcttctcattcattc |
13854027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2 times since January 2019
Visitors: 3264