View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0456_high_4 (Length: 407)
Name: NF0456_high_4
Description: NF0456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0456_high_4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 35 - 407
Target Start/End: Original strand, 6485626 - 6485998
Alignment:
| Q |
35 |
gaacctgtgctgtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485626 |
gaacctgtgctgtcaattgctaaagcagttactgcacattcttgttttaaaagttgtttaaccattacatgttttgttgctttaccacgtggttctcttc |
6485725 |
T |
|
| Q |
135 |
gccacactttaactgttccgtctgctgaaccagagaaaacaattccgtcgtttccacaaacgacggcgttaactgcatcctcatgggaagtagtggattc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6485726 |
gccacactttaactgttccgtctgctgaaccagagaaaacaattccgtcgtttccacaaacgacggcgttaactgcatcctcatgggaagtaatggattc |
6485825 |
T |
|
| Q |
235 |
caagcactttgaatcggcgattctccaaactttgacggttctgtcccatgaagcagagtagaggtaggttttgtctggagaaaggcttaggcatgcaact |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6485826 |
caagcactttgaatcggcgattctccaaactttgacggttctgtcccatgaagcagagtagaggtaggttttgtctggagaaagacttaggcatgaaact |
6485925 |
T |
|
| Q |
335 |
gcatccgaatgtttgatccataatgcagttcggtgttttctaacctcgacataattgcttggtttaatcgagc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6485926 |
gcatccgaatgtttgatccataatgcagttcggtgttttctaacctcgacataattgcttggtttaattgagc |
6485998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1792 times since January 2019
Visitors: 3237