View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0456_low_11 (Length: 319)
Name: NF0456_low_11
Description: NF0456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0456_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 45 - 278
Target Start/End: Original strand, 42037599 - 42037827
Alignment:
Q |
45 |
caaggaatctgcatcataaaccaacatcattgcaaagagaaacacctcaaaaagagtaaattaagaaagagnnnnnnnnnntattcactcacgggtttta |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
T |
42037599 |
caaggaatctgcatcataaaccaacatcattgcaaagagaaacacctcaaaaagagtaaattaagaaagaaagaaaa-----aatcactcacgggtttta |
42037693 |
T |
 |
Q |
145 |
agagttttgttaactcttgtacttttctcttccaattttcaataatatttctttgtttgccattnnnnnnnntacacatcagtattgataatataataag |
244 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
42037694 |
agagttttgttaactcttgtacttttctcctccaattttcaataatatttctttgtttgccattaaaaaaaatacacatcagtattgataatataataag |
42037793 |
T |
 |
Q |
245 |
cataagtatttacaatttcttaaggtgcatcatg |
278 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
42037794 |
cataagtatttacaatttcttaaggtgcatcatg |
42037827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 239 times since January 2019
Visitors: 3261