View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0456_low_16 (Length: 295)
Name: NF0456_low_16
Description: NF0456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0456_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 30 - 285
Target Start/End: Original strand, 6425064 - 6425319
Alignment:
| Q |
30 |
gtttgtcgagatctgacatttaaattgcttcttttccatatgttatatgatttgtgtattattctatgattttggtatatttctattgtgtggtctagtt |
129 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6425064 |
gtttgttgagatctgacatttaaattgcttcttttccatatgttatatgatttgtgtattattctatgattttggtatatttctattgtgtggtctagtt |
6425163 |
T |
|
| Q |
130 |
tcatagtacaaagatgaaatgctagtaattttagtagctatgattttaattggtttctggggtaacatctctaagagtttaatttaaggatataccaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6425164 |
tcatagtacaaagatgaaatgctagtaattttagtagctatgattttaattggtttctggggtaacatctctaagagtttaatttaaggatataccaatt |
6425263 |
T |
|
| Q |
230 |
atagaaagaagagagtgatttttgaggttcatgcttagatttttgttttagtatta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6425264 |
atagaaagaagagagtgatttttgaggttcatgcttagatttttgttttaatatta |
6425319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 103 times since January 2019
Visitors: 3258