View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0456_low_19 (Length: 273)
Name: NF0456_low_19
Description: NF0456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0456_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 42 - 264
Target Start/End: Complemental strand, 31488884 - 31488673
Alignment:
Q |
42 |
caattgtataatacatatcatatacttcttgaatacgcgagggatacgattgtagaaccatacacaggcggaatactatgtctttctattattaacatta |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||| | |||||||||||| |
|
|
T |
31488884 |
caattgtataatacatatcatatacttcttgaatacgtgagggatacgattgtagaacaaggcacaggcggaatactatctttttctattatta------ |
31488791 |
T |
 |
Q |
142 |
acatgatttttctactttttctttaaaagaccagaaaaatgaaaagannnnnnnnnnnnnnaccttatttatattatataatgatgttctttttgagata |
241 |
Q |
|
|
|||||||||||||||||||||||| ||||| ||||||||||||||| || ||| || |||||||||||||||||||||||||||| |
|
|
T |
31488790 |
acatgatttttctactttttcttt--aagactagaaaaatgaaaagattttttttttttttacaatatatacattatataatgatgttctttttgagata |
31488693 |
T |
 |
Q |
242 |
tagtttaatggcggtgatgatgt |
264 |
Q |
|
|
|||||||| |||||||||||| |
|
|
T |
31488692 |
tagtttaa---cggtgatgatgt |
31488673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University