View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457-Insertion-5 (Length: 142)
Name: NF0457-Insertion-5
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457-Insertion-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 2e-65; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 10664947 - 10664814
Alignment:
| Q |
8 |
caattggcatggaatcacatgcaaccccttactattatatcagttgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664947 |
caattggcatggaatcacatgcaaccccttactattgtatcagttgcactcaattattttaatggctcttttccacccagtatgttcaacaccctctcca |
10664848 |
T |
|
| Q |
108 |
atctcaggtctaatccctatttcacttgcaaatg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10664847 |
atctcaggtctaatccctatttcacttgcaaatg |
10664814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 47 - 111
Target Start/End: Complemental strand, 10661857 - 10661793
Alignment:
| Q |
47 |
tcagttgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct |
111 |
Q |
| |
|
||||||| || ||||||||||||||| ||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
10661857 |
tcagttggacccaatgattttaatggatctcttccatccaatatgttcaacaccctctccaatct |
10661793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 7191447 - 7191506
Alignment:
| Q |
52 |
tgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct |
111 |
Q |
| |
|
|||| ||||| |||||||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
7191447 |
tgcattcaataattttaatggatctcttccacccaatatgttcaacaccctctccaatct |
7191506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1288 times since January 2019
Visitors: 3440