View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457-Insertion-6 (Length: 141)
Name: NF0457-Insertion-6
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457-Insertion-6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 14741886 - 14741753
Alignment:
| Q |
8 |
ggtcttacgtttgttattcaagcacaaccttatttgaatgctgttcctatgccacttggtcttgaagttacttgtttgaaagcttgtactcattatccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14741886 |
ggtcttacgtttgttattcaagcacaaccttatttgaatgctgttcctatgccacttggtcttgaagttacttgtttgaaagcttgtactcattatccta |
14741787 |
T |
|
| Q |
108 |
ctctttttgatcattttcaaagagagttgcgtga |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14741786 |
ctctttttgatcattttcaaagagagttgcgtga |
14741753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University