View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457-Insertion-8 (Length: 102)
Name: NF0457-Insertion-8
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 29690784 - 29690877
Alignment:
| Q |
8 |
aaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690784 |
aaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgctt |
29690877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Original strand, 29718296 - 29718389
Alignment:
| Q |
8 |
aaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718296 |
aaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgctt |
29718389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1261 times since January 2019
Visitors: 3440