View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457_low_11 (Length: 315)
Name: NF0457_low_11
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0457_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 80 - 258
Target Start/End: Complemental strand, 37429584 - 37429405
Alignment:
Q |
80 |
agtaatgtcactgcccaattctgtactcccactaatatcggtcccactattatttgaagatgagcaccgaggggatggatgaaaagaaatttgttttgag |
179 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
37429584 |
agtaatgtcactgcccaattctgtactcccactaatgtcggtcccactattatttgaagatgagtaccaaggggatggatgaaaagaaatttgttttgag |
37429485 |
T |
 |
Q |
180 |
gcctgttcctcatttgtggcaggagactttttagcagctc-atctgcttcacttgcttgtgatggtggaattcttttctg |
258 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
37429484 |
gcctgttcctcatttgtggcaggagactttgtagcagctctttctgcttcacttgcttgtgatggtggaattcttttctg |
37429405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University