View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457_low_14 (Length: 308)
Name: NF0457_low_14
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 87 - 234
Target Start/End: Original strand, 27016240 - 27016387
Alignment:
| Q |
87 |
acctgtgaatccagatttacttctgcaccagagccaaacattacatctccttcttcaatagctcccatagcattcatggctttcatctcaaaattatctt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27016240 |
acctgtgaatccagatttacttctgcaccagagccaaacattacatctccttcttcaatagctcccatagcattcatggctttcatctcaaaattatctt |
27016339 |
T |
 |
| Q |
187 |
cagatggagcaggcttggatgccattgcttcctgaattcgtctctgct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27016340 |
cagatggagcaggcttggatgccattgcttcctgaattcgtctctgct |
27016387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 87 - 234
Target Start/End: Complemental strand, 41673876 - 41673729
Alignment:
| Q |
87 |
acctgtgaatccagatttacttctgcaccagagccaaacattacatctccttcttcaatagctcccatagcattcatggctttcatctcaaaattatctt |
186 |
Q |
| |
|
||||||||||| || | ||||| || ||||| ||||||| | | ||||| || || |||||||||||||| || | |||||||| ||| |||||||||| |
|
|
| T |
41673876 |
acctgtgaatcaaggctcacttcagctccagatccaaacactgcgtctccatcctccatagctcccatagctttaaaggctttcaactctaaattatctt |
41673777 |
T |
 |
| Q |
187 |
cagatggagcaggcttggatgccattgcttcctgaattcgtctctgct |
234 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
41673776 |
cagatggagctggctttgatgccattgcttcctgaatccgtctttgct |
41673729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University