View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457_low_18 (Length: 287)
Name: NF0457_low_18
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 65 - 251
Target Start/End: Complemental strand, 6450777 - 6450591
Alignment:
| Q |
65 |
agacaaagcatggaaggaagtgcaagtaggaattttagaaatgattccaaacaatcgtctgcttccaacgttaacatttaaaaattgaaaccctagcatt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6450777 |
agacaaagcatggaaggaagtgcaagtaggaattttagaaatgattccaaacaatcgtctgcttccaacgttaacatttaaaaattgaaaccctagcatt |
6450678 |
T |
|
| Q |
165 |
tgtctaattatgtaatgttgcaatccaatattccctctccgtgttcaaatattccatgtcttgtgtgtctctcacctcaattcatct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6450677 |
tgtctaattatgtaatgttgcaatccaatattccctctccgtgttcaaatattccatgtcttgtgtgtctctcacctcaattcatct |
6450591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 513 times since January 2019
Visitors: 3481