View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457_low_21 (Length: 258)
Name: NF0457_low_21
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0457_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 69 - 182
Target Start/End: Complemental strand, 17356249 - 17356138
Alignment:
| Q |
69 |
atgaatttagaataatttttcatgaaaaatccaaaacaattatatgctgcttttctacaaacaataaggtgaaggaaaacaacaaatcacgaaatcgaag |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17356249 |
atgaatttagaataatttttcatgaaaaatccaaaacaattat--gctgcttttgtacaaacaagaaggtgaagaaaaacaacaaatcacgaaatcgaag |
17356152 |
T |
 |
| Q |
169 |
ttcgcatgaagcac |
182 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17356151 |
ttcgcatgaagcac |
17356138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 36619953 - 36620017
Alignment:
| Q |
114 |
gctgcttttctacaaacaataaggtgaaggaaaacaacaaatcacgaaatcgaagttcgcatgaa |
178 |
Q |
| |
|
||||||| | || ||||||||| |||||||||||||||||| | | |||| ||||||| |||||| |
|
|
| T |
36619953 |
gctgcttctgtagaaacaataaagtgaaggaaaacaacaaaacgcaaaattgaagttcacatgaa |
36620017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University