View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0457_low_8 (Length: 339)
Name: NF0457_low_8
Description: NF0457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0457_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 80 - 241
Target Start/End: Complemental strand, 30409443 - 30409284
Alignment:
Q |
80 |
gcacagactgactagttgggaatgggaagtgtatggttttcgttaagctaagccccctttgaatttgagttaaaagaaaacatctaaactctaaacacaa |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30409443 |
gcacagactgactagttgggaatgggaagtgtatggttttcgttaagctaagccc--tttgaatttgagttaaaagaaaacatctaaactctaaacacaa |
30409346 |
T |
 |
Q |
180 |
taaagtgttgcgttatttgaatatcaaaatacatacatcacattatgcagaggggtcatatc |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30409345 |
taaagtgttgcgttatttgaatatcaaaatacatacatcacattatgcagaggggtcatatc |
30409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 183
Target Start/End: Complemental strand, 30411898 - 30411848
Alignment:
Q |
137 |
tttgaatttgagttaaaa----gaaaacatctaaactctaaacacaataaa |
183 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
30411898 |
tttgaatttgagttaaaatatagaaaacatctaaactctaaatacaataaa |
30411848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University