View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0458_low_6 (Length: 291)
Name: NF0458_low_6
Description: NF0458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0458_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 53675331 - 53675586
Alignment:
| Q |
9 |
agcacagatataacatatgcttttgcttgcctaagttgtgattgtcttcttctcactgatacacgtttcttcatattctctgctactgaaaattgaacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675331 |
agcacagatataacatatgcttttgcttgcctaagttgtgattgtcttcttctcactgatacacgtttcttcatattctctgctactgaaaattgaacaa |
53675430 |
T |
|
| Q |
109 |
attttcaggctattaaaagaacactaataattcacagtatgaaaaaacggttgaataaattgtacatgttaaaat--nnnnnnnnntagtgactaaccaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53675431 |
attttcaggctattaaaagaacactaataattcacagtatgaaaaaacggttgaataaattgtacatgttaaaataaaaaaaaaaacagtgactaaccaa |
53675530 |
T |
|
| Q |
207 |
gaacatgcacagcaacaatggtatcatttggattagctaaaactcttattgcccat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675531 |
gaacatgcacagcaacaatggtatcatttggattagctaaaactcttattgcccat |
53675586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 220 times since January 2019
Visitors: 3465