View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0459_high_2 (Length: 260)
Name: NF0459_high_2
Description: NF0459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0459_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 113 - 232
Target Start/End: Complemental strand, 26861895 - 26861774
Alignment:
Q |
113 |
aacatggtagttatataaacaagagagaaagggagaga--ttagaaacatacccttaagagaggtaaagaggcattgagattgaggtatgaactcttgtt |
210 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26861895 |
aacatggtagttatataaacaagagagaaagagagagagattagaaacatacccttaagagaggtaaagaggcattgagattgaggtatgaactcttgtt |
26861796 |
T |
 |
Q |
211 |
ggtagagaaaagagaacaactt |
232 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
26861795 |
ggtagagaaaagagaacaactt |
26861774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 26861994 - 26861944
Alignment:
Q |
1 |
cttcattgatatatgaagaattaatccaatagacacgttgatttgattact |
51 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
26861994 |
cttcattgatataggaagaattaatccaatagacacgttgatttgattact |
26861944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 336 times since January 2019
Visitors: 3470